ID: 1113183933_1113183936

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1113183933 1113183936
Species Human (GRCh38) Human (GRCh38)
Location 13:107664471-107664493 13:107664492-107664514
Sequence CCATTGTTTCCTATTTAATGCAA AAAGGAAAAGCCAACACCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 392} {0: 1, 1: 0, 2: 0, 3: 19, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!