|
Left Crispr |
Right Crispr |
Crispr ID |
1113269316 |
1113269322 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:108655537-108655559
|
13:108655578-108655600
|
Sequence |
CCACTGGGGCACTGCCTAGTGGA |
CCATCTTCCAGACCCCAGAATGG |
Strand |
- |
+ |
Off-target summary |
{0: 668, 1: 1163, 2: 1065, 3: 900, 4: 652} |
{0: 67, 1: 862, 2: 1366, 3: 1582, 4: 1484} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|