ID: 1113294302_1113294307

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113294302 1113294307
Species Human (GRCh38) Human (GRCh38)
Location 13:108941066-108941088 13:108941115-108941137
Sequence CCACAGGCTGGAAACAAAAATGA GAGTGAGACACAGGCTGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 328} {0: 1, 1: 0, 2: 5, 3: 46, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!