ID: 1113424077_1113424084

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113424077 1113424084
Species Human (GRCh38) Human (GRCh38)
Location 13:110193606-110193628 13:110193642-110193664
Sequence CCCATGCCAGGGACATCGAGGCG CTTCCCATCCCTGCCCTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 75} {0: 1, 1: 0, 2: 3, 3: 55, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!