ID: 1113437971_1113437983

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1113437971 1113437983
Species Human (GRCh38) Human (GRCh38)
Location 13:110307656-110307678 13:110307694-110307716
Sequence CCGAGCTCCTCGGCCAAGGAGCA CGGGAGGCTCTCCTTCTTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 191} {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!