ID: 1113543913_1113543925

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1113543913 1113543925
Species Human (GRCh38) Human (GRCh38)
Location 13:111131624-111131646 13:111131671-111131693
Sequence CCTGAAGAGAGAAACTAAGGCAG GGGCAGTGACCTGAGGTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 298} {0: 1, 1: 1, 2: 4, 3: 71, 4: 585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!