ID: 1113554065_1113554068

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1113554065 1113554068
Species Human (GRCh38) Human (GRCh38)
Location 13:111216894-111216916 13:111216945-111216967
Sequence CCTTCCTCTTTCTGCCTTTCAGA AAAATGCGAATTAAAATACGAGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 19, 3: 100, 4: 888} {0: 1, 1: 0, 2: 0, 3: 19, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!