ID: 1113586332_1113586342

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1113586332 1113586342
Species Human (GRCh38) Human (GRCh38)
Location 13:111468484-111468506 13:111468507-111468529
Sequence CCCAGGACCCTCACCGGCCCGGC TGTGGGCCGGTCCAAACCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!