ID: 1113607489_1113607494

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1113607489 1113607494
Species Human (GRCh38) Human (GRCh38)
Location 13:111620736-111620758 13:111620761-111620783
Sequence CCTCTCCTGGGGGGCTGTGGGAA CCTGGCTGCAGGTCAGCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 292} {0: 1, 1: 0, 2: 2, 3: 38, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!