ID: 1113692648_1113692651

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1113692648 1113692651
Species Human (GRCh38) Human (GRCh38)
Location 13:112322608-112322630 13:112322638-112322660
Sequence CCAGTTCAAGCTGGCATAGGAAA AAGGCATTCAACGCGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 150} {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!