ID: 1113746753_1113746760

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1113746753 1113746760
Species Human (GRCh38) Human (GRCh38)
Location 13:112750459-112750481 13:112750499-112750521
Sequence CCCTCTTCAGCCTCTCGTGAATT GAGTCTCCATCCTCCCACGTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 0, 3: 14, 4: 193} {0: 9, 1: 2, 2: 2, 3: 14, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!