ID: 1113752502_1113752508

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113752502 1113752508
Species Human (GRCh38) Human (GRCh38)
Location 13:112785986-112786008 13:112786023-112786045
Sequence CCCACGCACACGCGTGGACGGGC ACTGTGCTTTCCAGGTAATGCGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 0, 3: 6, 4: 30} {0: 7, 1: 0, 2: 0, 3: 24, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!