ID: 1113754463_1113754466

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1113754463 1113754466
Species Human (GRCh38) Human (GRCh38)
Location 13:112801018-112801040 13:112801037-112801059
Sequence CCCTACAGCTGACGTCATACTTA CTTAATGGTGAAAAACGAGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 21, 3: 88, 4: 225} {0: 1, 1: 0, 2: 1, 3: 14, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!