ID: 1113777203_1113777220

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1113777203 1113777220
Species Human (GRCh38) Human (GRCh38)
Location 13:112954594-112954616 13:112954634-112954656
Sequence CCTCAGTGGGCTCTTCCCACTGG AGGGGGCATGGGTGGGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 323} {0: 1, 1: 0, 2: 3, 3: 35, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!