ID: 1113778709_1113778716

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113778709 1113778716
Species Human (GRCh38) Human (GRCh38)
Location 13:112963539-112963561 13:112963576-112963598
Sequence CCTCCCTGCACCTGTGTCTCCAG TGCTGCTCCATAGCCTGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 520} {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!