ID: 1113786449_1113786463

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113786449 1113786463
Species Human (GRCh38) Human (GRCh38)
Location 13:113004407-113004429 13:113004443-113004465
Sequence CCGTCACTCCATGTCTGCAGCTG CCCCCATGGCGCAGTGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 288} {0: 1, 1: 0, 2: 2, 3: 15, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!