ID: 1113807350_1113807353

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1113807350 1113807353
Species Human (GRCh38) Human (GRCh38)
Location 13:113117618-113117640 13:113117642-113117664
Sequence CCGACCGCGGTGCTGGGTGGGTG CACTCTTCCCTGTCCGACCGCGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 0, 3: 8, 4: 111} {0: 1, 1: 3, 2: 1, 3: 9, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!