ID: 1113807350_1113807358

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1113807350 1113807358
Species Human (GRCh38) Human (GRCh38)
Location 13:113117618-113117640 13:113117652-113117674
Sequence CCGACCGCGGTGCTGGGTGGGTG TGTCCGACCGCGGTGCTGGGTGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 0, 3: 8, 4: 111} {0: 5, 1: 0, 2: 0, 3: 1, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!