ID: 1113810097_1113810105

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1113810097 1113810105
Species Human (GRCh38) Human (GRCh38)
Location 13:113135579-113135601 13:113135629-113135651
Sequence CCTAATCACCTCCTAAAGATCTC AAATTTTAACATATGTATGGGGG
Strand - +
Off-target summary {0: 1, 1: 15, 2: 173, 3: 796, 4: 2322} {0: 1, 1: 0, 2: 4, 3: 63, 4: 666}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!