ID: 1113821236_1113821240

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1113821236 1113821240
Species Human (GRCh38) Human (GRCh38)
Location 13:113214957-113214979 13:113214975-113214997
Sequence CCCATGTGGCTGTGGACATCTTG TCTTGTCTGTGTGGCTGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 182} {0: 1, 1: 3, 2: 4, 3: 46, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!