ID: 1113821997_1113822000

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1113821997 1113822000
Species Human (GRCh38) Human (GRCh38)
Location 13:113221304-113221326 13:113221325-113221347
Sequence CCAGAATTAGATTGTTCATGGAG AGGTCACTCTGGCAGAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90} {0: 1, 1: 0, 2: 2, 3: 17, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!