ID: 1113852581_1113852597

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1113852581 1113852597
Species Human (GRCh38) Human (GRCh38)
Location 13:113426300-113426322 13:113426332-113426354
Sequence CCCTGCCCGCCACACCCCACCTC GGCACCGCGGGAGCCACAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 111, 4: 1103} {0: 1, 1: 0, 2: 0, 3: 17, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!