ID: 1113861528_1113861540

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1113861528 1113861540
Species Human (GRCh38) Human (GRCh38)
Location 13:113490581-113490603 13:113490620-113490642
Sequence CCACATCCAGCGCGCCGCCTGCG ACCCCGACCCCGACCCCGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 100} {0: 1, 1: 2, 2: 8, 3: 35, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!