ID: 1113879502_1113879508

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1113879502 1113879508
Species Human (GRCh38) Human (GRCh38)
Location 13:113615880-113615902 13:113615905-113615927
Sequence CCAGCCTGAGTGACAGAGCCAGA CTGTCTCAAAATGAGTAGGCTGG
Strand - +
Off-target summary {0: 131, 1: 4561, 2: 59488, 3: 146241, 4: 170325} {0: 1, 1: 0, 2: 3, 3: 24, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!