ID: 1113897728_1113897732

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113897728 1113897732
Species Human (GRCh38) Human (GRCh38)
Location 13:113776494-113776516 13:113776530-113776552
Sequence CCCACCTGCTGCTGTCCGAGCTG TGACCCCACCTCAGAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 235} {0: 1, 1: 0, 2: 2, 3: 39, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!