ID: 1113937248_1113937255

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1113937248 1113937255
Species Human (GRCh38) Human (GRCh38)
Location 13:114001001-114001023 13:114001019-114001041
Sequence CCCCCCACTTTCTGCGTTCTGAG CTGAGACCTGAGGCAGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 241} {0: 1, 1: 0, 2: 14, 3: 83, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!