ID: 1113957211_1113957225

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1113957211 1113957225
Species Human (GRCh38) Human (GRCh38)
Location 13:114105243-114105265 13:114105295-114105317
Sequence CCTTGGGCTCCAGCCTCATCCCC GTGCCATGGACCCTGCACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 70, 4: 712} {0: 1, 1: 0, 2: 4, 3: 26, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!