ID: 1114133155_1114133161

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1114133155 1114133161
Species Human (GRCh38) Human (GRCh38)
Location 14:19816706-19816728 14:19816732-19816754
Sequence CCCTGGCCAGAACTTCCAATACT TTGAATAAGGATGGTGAGAAAGG
Strand - +
Off-target summary {0: 1996, 1: 10826, 2: 3856, 3: 1322, 4: 787} {0: 1, 1: 8, 2: 90, 3: 1149, 4: 12802}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!