ID: 1114179831_1114179840

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1114179831 1114179840
Species Human (GRCh38) Human (GRCh38)
Location 14:20356836-20356858 14:20356875-20356897
Sequence CCCTCTTTCTTTAAATTCCTAAA CTCAGAAGGCGGAAATTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 728} {0: 1, 1: 0, 2: 1, 3: 8, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!