ID: 1114190027_1114190032

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1114190027 1114190032
Species Human (GRCh38) Human (GRCh38)
Location 14:20433955-20433977 14:20433986-20434008
Sequence CCTTGTAATTTTAAACTTTCAAT ATGGCCTAGTGGAAGGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 74, 4: 748} {0: 1, 1: 0, 2: 2, 3: 38, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!