ID: 1114192743_1114192746

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1114192743 1114192746
Species Human (GRCh38) Human (GRCh38)
Location 14:20452689-20452711 14:20452734-20452756
Sequence CCTCATACCCTTTCGTGATCTTT CAGTCTCAGCTCTGTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 157} {0: 5, 1: 18, 2: 116, 3: 411, 4: 1359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!