ID: 1114201880_1114201890

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1114201880 1114201890
Species Human (GRCh38) Human (GRCh38)
Location 14:20528888-20528910 14:20528934-20528956
Sequence CCAGTCTCAGAGCAGGAGGTAGT GAGTGGAGACGGGCATTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 13, 4: 147} {0: 1, 1: 2, 2: 1, 3: 13, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!