ID: 1114476606_1114476611

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1114476606 1114476611
Species Human (GRCh38) Human (GRCh38)
Location 14:22999449-22999471 14:22999494-22999516
Sequence CCTCCTCCTCACCATCTTTACTG TGCTTTGACATTGTTCCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 532} {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!