ID: 1114515005_1114515010

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1114515005 1114515010
Species Human (GRCh38) Human (GRCh38)
Location 14:23293487-23293509 14:23293517-23293539
Sequence CCACAGAGACCCTGGACAATAAG GAGAACCCACTTACCTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 175} {0: 1, 1: 0, 2: 1, 3: 21, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!