ID: 1114516156_1114516161

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1114516156 1114516161
Species Human (GRCh38) Human (GRCh38)
Location 14:23301584-23301606 14:23301608-23301630
Sequence CCAATCGGCGGCGCGGGCAGGCG AAGGCGAAGCGGTCGGCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 59} {0: 1, 1: 0, 2: 1, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!