ID: 1114516474_1114516483

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1114516474 1114516483
Species Human (GRCh38) Human (GRCh38)
Location 14:23302820-23302842 14:23302873-23302895
Sequence CCTCCTGCTAGCGGTCTGCTCTG TTCCAAGGCCCTCACGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 118} {0: 1, 1: 0, 2: 2, 3: 40, 4: 686}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!