ID: 1114553719_1114553724

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1114553719 1114553724
Species Human (GRCh38) Human (GRCh38)
Location 14:23549586-23549608 14:23549633-23549655
Sequence CCTAGGAAGAAGATGAACTAAAA TAGAATGAACTGAAGGATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 489} {0: 1, 1: 0, 2: 3, 3: 31, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!