ID: 1114577017_1114577019

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1114577017 1114577019
Species Human (GRCh38) Human (GRCh38)
Location 14:23724778-23724800 14:23724816-23724838
Sequence CCACTAGGTGGTAGCAGTGGAAA ATTTTGATGTATAGTGAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 28, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!