ID: 1114612814_1114612822

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1114612814 1114612822
Species Human (GRCh38) Human (GRCh38)
Location 14:24053447-24053469 14:24053490-24053512
Sequence CCGTCCCCTGACTCAGGGACATC CACCCTACTCCCTCTCTAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 267} {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!