ID: 1114613049_1114613060

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1114613049 1114613060
Species Human (GRCh38) Human (GRCh38)
Location 14:24054566-24054588 14:24054612-24054634
Sequence CCTTCCTCCTTCCCCTGGGCCAG TCCCCACTCCTGGTTTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 122, 4: 873} {0: 1, 1: 0, 2: 2, 3: 31, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!