ID: 1114633648_1114633657

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1114633648 1114633657
Species Human (GRCh38) Human (GRCh38)
Location 14:24175263-24175285 14:24175305-24175327
Sequence CCCAAAGTGCTGGGATTACAGAC CTTCTTGCACAAATTGATGAGGG
Strand - +
Off-target summary {0: 8926, 1: 233921, 2: 277195, 3: 180913, 4: 143944} {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!