ID: 1114656743_1114656750

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1114656743 1114656750
Species Human (GRCh38) Human (GRCh38)
Location 14:24320472-24320494 14:24320517-24320539
Sequence CCTTGTGTCTGTAAGAGAAGAAA GAGAGCAGGGAGCAGGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 624} {0: 1, 1: 0, 2: 6, 3: 53, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!