ID: 1114657342_1114657353

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1114657342 1114657353
Species Human (GRCh38) Human (GRCh38)
Location 14:24324047-24324069 14:24324077-24324099
Sequence CCCCTCTGTCCTCACCAGGCTGG CATGGCAAAGACAAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 55, 4: 533} {0: 1, 1: 1, 2: 1, 3: 49, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!