ID: 1114683318_1114683323

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1114683318 1114683323
Species Human (GRCh38) Human (GRCh38)
Location 14:24505623-24505645 14:24505644-24505666
Sequence CCACCCCAGCACACAGAAGAGGG GGCCCCCAGAGTCTCCCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 334} {0: 1, 1: 0, 2: 5, 3: 28, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!