ID: 1115023139_1115023144

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1115023139 1115023144
Species Human (GRCh38) Human (GRCh38)
Location 14:28707522-28707544 14:28707571-28707593
Sequence CCTGAGAATACTACTTCAGTTCT CAGTGGGACCAAAAGCAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 16, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!