ID: 1115179413_1115179418

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1115179413 1115179418
Species Human (GRCh38) Human (GRCh38)
Location 14:30605055-30605077 14:30605080-30605102
Sequence CCCAGCTTATTTTGTATTTTCAG GAGACAGGGTTTCTCCCTGTGGG
Strand - +
Off-target summary {0: 3, 1: 353, 2: 9351, 3: 22909, 4: 14812} {0: 46, 1: 5983, 2: 51005, 3: 107740, 4: 139526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!