|
Left Crispr |
Right Crispr |
Crispr ID |
1115179413 |
1115179418 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:30605055-30605077
|
14:30605080-30605102
|
Sequence |
CCCAGCTTATTTTGTATTTTCAG |
GAGACAGGGTTTCTCCCTGTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 353, 2: 9351, 3: 22909, 4: 14812} |
{0: 46, 1: 5983, 2: 51005, 3: 107740, 4: 139526} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|