ID: 1115265198_1115265201

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1115265198 1115265201
Species Human (GRCh38) Human (GRCh38)
Location 14:31493242-31493264 14:31493269-31493291
Sequence CCCACTCACTGCTGGTTCCTCTT TTACCACAGCTGATGCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 55, 4: 315} {0: 8, 1: 96, 2: 144, 3: 155, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!