ID: 1115324657_1115324666

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1115324657 1115324666
Species Human (GRCh38) Human (GRCh38)
Location 14:32126304-32126326 14:32126342-32126364
Sequence CCATGTTCCCTCTGAGACTCTAG CTCTTTCTTGCTTCTGGTGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 18, 3: 56, 4: 310} {0: 1, 1: 4, 2: 35, 3: 114, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!