ID: 1115359874_1115359885

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1115359874 1115359885
Species Human (GRCh38) Human (GRCh38)
Location 14:32488727-32488749 14:32488772-32488794
Sequence CCAGATAGCACGGTCCTTCACTC CCTGACCCCTTGTGCTTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 107} {0: 384, 1: 1323, 2: 1305, 3: 1243, 4: 1152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!