ID: 1115449424_1115449430

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1115449424 1115449430
Species Human (GRCh38) Human (GRCh38)
Location 14:33529030-33529052 14:33529068-33529090
Sequence CCCCAAATCTTGACTTAGAACAA TAAAATATGACTAATGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 254} {0: 1, 1: 0, 2: 3, 3: 20, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!